Recent questions tagged molecular basis of inheritance

+3 votes

1 answer

Bio listics (gene-***) is suitable for (a) DNA finger printing. (b) Disarming pathogen vectors.

asked Apr 7, 2019 in Class 12 by kratos

+2 votes

1 answer

Another name for reverse transcriptase is (A) DNA dependent DNA polymerase (B) DNA dependent RNA polymerase

asked Apr 7, 2019 in Class 12 by kratos

+2 votes

1 answer

Name the enzyme that transcribes hnRNA in eukaryotes.

asked Apr 7, 2019 in Class 12 by kratos

+3 votes

1 answer

Which one out of Rho factor and Sigma factor acts as the initiation factor during transcription in a prokaryote?

asked Apr 7, 2019 in Class 12 by kratos

+1 vote

1 answer

Draw the double helical structure of DNA as proposed by Watson and Crick.

asked Apr 6, 2019 in Class 12 by kratos

+3 votes

1 answer

Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid

asked Apr 6, 2019 in Class 12 by kratos

+3 votes

1 answer

A DNA nucletotide chain has A G C T T C G A sequence The nucleotide sequence of other chain would be

asked Apr 6, 2019 in Class 12 by kratos

+1 vote

1 answer

What are heterochromatin and euchromatin?

asked Apr 6, 2019 in Class 12 by kratos

+2 votes

1 answer

How many structural genes are present in lac-operon in E.coli? (a) 4 (b) 3 (c) 2 (d) 1

asked Apr 6, 2019 in Class 12 by kratos

+3 votes

1 answer

यदि अनुलेखन इकाई में कूट लेखन रज्जुक के अनुक्रम को निम्नवत् लिखा गया है – 5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′

asked Apr 5, 2019 in Class 12 by kratos

+2 votes

1 answer

Study the mRNA segment given above which is complete to be translated into a polypeptide chain.

asked Apr 5, 2019 in Class 12 by kratos

+2 votes

1 answer

Which of the following switch *** lac operon

asked Apr 5, 2019 in Class 12 by kratos

+1 vote

1 answer

If the sequence of nitrogen bases of the coding strand of DNA in a transcription unit is:

asked Apr 5, 2019 in Class 12 by kratos

+1 vote

1 answer

Polysome is formed by

asked Apr 5, 2019 in Class 12 by kratos

+3 votes

1 answer

During DNA replication, why is it that the entire molecule does not open in one go? Explain replication fork.

asked Apr 5, 2019 in Class 12 by kratos

+1 vote

1 answer

Explain the process of DNA replication with the help of schematic diagram.

asked Apr 5, 2019 in Class 12 by kratos

+1 vote

1 answer

Give an account of post transcriptional modifications of an eukaryotic mRNA. “

asked Apr 4, 2019 in Class 12 by kratos

+2 votes

1 answer

How does the flow of information in *** deviate from the Central Dogma proposed by Francis Crick.

asked Apr 4, 2019 in Class 12 by kratos

+1 vote

1 answer

Operon model is proposed by- (a) Watson and Crick (b) Briton and Davidson (d) Jacob and Monad

asked Apr 4, 2019 in Class 12 by kratos

+3 votes

1 answer

A nucleoside differs from a nucleotide. It lacks the: a. base

asked Apr 4, 2019 in Class 12 by kratos

To see more, click for the full list of questions or popular tags.

...